##############################################################################
##############################################################################
###
### Running command:
###
### /home/biocbuild/bbs-3.20-bioc/R/bin/R CMD build --keep-empty-dirs --no-resave-data --md5 Rfastp
###
##############################################################################
##############################################################################
* checking for file ‘Rfastp/DESCRIPTION’ ... OK
* preparing ‘Rfastp’:
* checking DESCRIPTION meta-information ... OK
* cleaning src
* running ‘cleanup’
* installing the package to build vignettes
* creating vignettes ... ERROR
--- re-building ‘Rfastp.Rmd’ using rmarkdown
Detecting adapter sequence for read1...
No adapter detected for read1
[19:7:24] start to load data
[19:7:24] all reads loaded, start to monitor thread status
[19:7:24] thread 2 is processing the 9 / 11 pack
[19:7:24] thread 4 is processing the 10 / 11 pack
[19:7:24] thread 4 data processing completed
[19:7:24] thread 4 finished
[19:7:24] thread 3 data processing completed
[19:7:24] thread 3 finished
[19:7:24] thread 1 data processing completed
[19:7:24] thread 1 finished
[19:7:24] thread 2 data processing completed
[19:7:24] thread 2 finished
[19:7:24] /tmp/RtmpHs7K7w/file53bb223c533b0_se_R1.fastq.gz writer finished
[19:7:24] start to generate reports
Read1 before filtering:
total reads: 10000
total bases: 510000
Q20 bases: 475322(93.2004%)
Q30 bases: 449228(88.0839%)
Read1 after filtering:
total reads: 9479
total bases: 483429
Q20 bases: 469954(97.2126%)
Q30 bases: 446249(92.3091%)
Filtering result:
reads passed filter: 9479
reads failed due to low quality: 517
reads failed due to too many N: 4
reads failed due to too short: 0
reads with adapter trimmed: 0
bases trimmed due to adapters: 0
Duplication rate (may be overestimated since this is SE data): 1.11726%
Detecting adapter sequence for read1...
No adapter detected for read1
Detecting adapter sequence for read2...
No adapter detected for read2
[19:7:24] start to load data
[19:7:24] all reads loaded, start to monitor thread status
[19:7:24] thread 1 is processing the 0 / 2 pack
[19:7:24] thread 2 is processing the 0 / 2 pack
[19:7:24] thread 2 data processing completed
[19:7:24] thread 2 finished
[19:7:24] thread 1 data processing completed
[19:7:24] thread 1 finished
[19:7:24] /tmp/RtmpHs7K7w/file53bb223c533b0_pe_R2.fastq.gz writer finished
[19:7:24] /tmp/RtmpHs7K7w/file53bb223c533b0_pe_R1.fastq.gz writer finished
[19:7:24] start to generate reports
Read1 before filtering:
total reads: 1000
total bases: 100000
Q20 bases: 100000(100%)
Q30 bases: 100000(100%)
Read2 before filtering:
total reads: 1000
total bases: 100000
Q20 bases: 100000(100%)
Q30 bases: 100000(100%)
Read1 after filtering:
total reads: 1000
total bases: 100000
Q20 bases: 100000(100%)
Q30 bases: 100000(100%)
Read2 after filtering:
total reads: 1000
total bases: 100000
Q20 bases: 100000(100%)
Q30 bases: 100000(100%)
Filtering result:
reads passed filter: 2000
reads failed due to low quality: 0
reads failed due to too many N: 0
reads failed due to too short: 0
reads with adapter trimmed: 0
bases trimmed due to adapters: 0
Duplication rate: 0%
Insert size peak (evaluated by paired-end reads): 100
Detecting adapter sequence for read1...
No adapter detected for read1
Detecting adapter sequence for read2...
No adapter detected for read2
[19:7:25] start to load data
[19:7:25] all reads loaded, start to monitor thread status
[19:7:25] thread 1 is processing the 0 / 2 pack
[19:7:25] thread 2 is processing the 0 / 2 pack
[19:7:25] thread 2 data processing completed
[19:7:25] thread 2 finished
[19:7:25] thread 1 data processing completed
[19:7:25] thread 1 finished
[19:7:25] /tmp/RtmpHs7K7w/file53bb223c533b0_merged.fastq.gz writer finished
[19:7:25] /tmp/RtmpHs7K7w/file53bb223c533b0_merged.fastq.gz writer finished
[19:7:25] /tmp/RtmpHs7K7w/file53bb223c533b0_unpaired_R1.fastq.gz writer finished
[19:7:25] /tmp/RtmpHs7K7w/file53bb223c533b0_unpaired_R2.fastq.gz writer finished
[19:7:25] start to generate reports
Read1 before filtering:
total reads: 1000
total bases: 100000
Q20 bases: 100000(100%)
Q30 bases: 100000(100%)
Read2 before filtering:
total reads: 1000
total bases: 100000
Q20 bases: 100000(100%)
Q30 bases: 100000(100%)
Merged and filtered:
total reads: 1
total bases: 100
Q20 bases: 100(100%)
Q30 bases: 100(100%)
Filtering result:
reads passed filter: 2000
reads failed due to low quality: 0
reads failed due to too many N: 0
reads failed due to too short: 0
reads with adapter trimmed: 0
bases trimmed due to adapters: 0
reads corrected by overlap analysis: 0
bases corrected by overlap analysis: 0
Duplication rate: 0%
Insert size peak (evaluated by paired-end reads): 100
Read pairs merged: 1
% of original read pairs: 0.1%
% in reads after filtering: 100%
Detecting adapter sequence for read1...
No adapter detected for read1
Detecting adapter sequence for read2...
No adapter detected for read2
[19:7:25] start to load data
[19:7:25] all reads loaded, start to monitor thread status
[19:7:25] thread 1 is processing the 0 / 2 pack
[19:7:25] thread 2 is processing the 0 / 2 pack
[19:7:25] thread 2 data processing completed
[19:7:25] thread 2 finished
[19:7:25] thread 1 data processing completed
[19:7:25] thread 1 finished
[19:7:25] /tmp/RtmpHs7K7w/file53bb223c533b0_umi1_R1.fastq.gz writer finished
[19:7:25] /tmp/RtmpHs7K7w/file53bb223c533b0_umi1_R2.fastq.gz writer finished
[19:7:25] start to generate reports
Read1 before filtering:
total reads: 1000
total bases: 100000
Q20 bases: 100000(100%)
Q30 bases: 100000(100%)
Read2 before filtering:
total reads: 1000
total bases: 100000
Q20 bases: 100000(100%)
Q30 bases: 100000(100%)
Read1 after filtering:
total reads: 1000
total bases: 83957
Q20 bases: 83957(100%)
Q30 bases: 83957(100%)
Read2 after filtering:
total reads: 1000
total bases: 99941
Q20 bases: 99941(100%)
Q30 bases: 99941(100%)
Filtering result:
reads passed filter: 2000
reads failed due to low quality: 0
reads failed due to too many N: 0
reads failed due to too short: 0
reads with adapter trimmed: 2
bases trimmed due to adapters: 102
Duplication rate: 0%
Insert size peak (evaluated by paired-end reads): 41
Detecting adapter sequence for read1...
No adapter detected for read1
Detecting adapter sequence for read2...
No adapter detected for read2
[19:7:26] start to load data
[19:7:26] all reads loaded, start to monitor thread status
[19:7:26] thread 1 is processing the 0 / 2 pack
[19:7:26] thread 2 is processing the 0 / 2 pack
[19:7:26] thread 2 data processing completed
[19:7:26] thread 2 finished
[19:7:26] thread 1 data processing completed
[19:7:26] thread 1 finished
[19:7:26] /tmp/RtmpHs7K7w/file53bb223c533b0_umi2_R1.fastq.gz writer finished
[19:7:26] /tmp/RtmpHs7K7w/file53bb223c533b0_umi2_R2.fastq.gz writer finished
[19:7:26] start to generate reports
Read1 before filtering:
total reads: 1000
total bases: 100000
Q20 bases: 100000(100%)
Q30 bases: 100000(100%)
Read2 before filtering:
total reads: 1000
total bases: 100000
Q20 bases: 100000(100%)
Q30 bases: 100000(100%)
Read1 after filtering:
total reads: 1000
total bases: 83957
Q20 bases: 83957(100%)
Q30 bases: 83957(100%)
Read2 after filtering:
total reads: 1000
total bases: 99941
Q20 bases: 99941(100%)
Q30 bases: 99941(100%)
Filtering result:
reads passed filter: 2000
reads failed due to low quality: 0
reads failed due to too many N: 0
reads failed due to too short: 0
reads with adapter trimmed: 2
bases trimmed due to adapters: 102
Duplication rate: 0%
Insert size peak (evaluated by paired-end reads): 41
[19:7:26] start to load data
[19:7:26] all reads loaded, start to monitor thread status
[19:7:26] thread 1 is processing the 8 / 11 pack
[19:7:26] thread 2 is processing the 9 / 11 pack
[19:7:26] thread 1 is processing the 10 / 11 pack
[19:7:26] thread 1 data processing completed
[19:7:26] thread 1 finished
[19:7:26] thread 2 data processing completed
[19:7:26] thread 2 finished
[19:7:26] /tmp/RtmpHs7K7w/file53bb223c533b0_clipr_R1.fastq.gz writer finished
[19:7:26] start to generate reports
Read1 before filtering:
total reads: 10000
total bases: 510000
Q20 bases: 475322(93.2004%)
Q30 bases: 449228(88.0839%)
Read1 after filtering:
total reads: 9075
total bases: 415882
Q20 bases: 407096(97.8874%)
Q30 bases: 387265(93.119%)
Filtering result:
reads passed filter: 9075
reads failed due to low quality: 1
reads failed due to too many N: 1
reads failed due to too short: 923
reads with adapter trimmed: 3708
bases trimmed due to adapters: 54289
Duplication rate (may be overestimated since this is SE data): 1.11726%
Detecting adapter sequence for read1...
No adapter detected for read1
[19:7:27] start to load data
[19:7:27] all reads loaded, start to monitor thread status
[19:7:27] thread 1 is processing the 8 / 11 pack
[19:7:27] thread 2 is processing the 9 / 11 pack
[19:7:27] thread 1 is processing the 10 / 11 pack
[19:7:27] thread 1 data processing completed
[19:7:27] thread 1 finished
[19:7:27] thread 2 data processing completed
[19:7:27] thread 2 finished
[19:7:27] /tmp/RtmpHs7K7w/file53bb223c533b0_merged1_R1.fastq.gz writer finished
[19:7:27] start to generate reports
Read1 before filtering:
total reads: 10000
total bases: 1000000
Q20 bases: 979566(97.9566%)
Q30 bases: 943738(94.3738%)
Read1 after filtering:
total reads: 9990
total bases: 999000
Q20 bases: 979011(97.9991%)
Q30 bases: 943328(94.4272%)
Filtering result:
reads passed filter: 9990
reads failed due to low quality: 10
reads failed due to too many N: 0
reads failed due to too short: 0
reads with adapter trimmed: 0
bases trimmed due to adapters: 0
Duplication rate (may be overestimated since this is SE data): 6.73077%
rfastp package:Rfastp R Documentation
_R _w_r_a_p _o_f _f_a_s_t_p
_D_e_s_c_r_i_p_t_i_o_n:
Quality control (Cut adapter, low quality trimming, polyX
trimming, UMI handling, and etc.) of fastq files.
_U_s_a_g_e:
rfastp(
read1,
read2 = "",
outputFastq,
unpaired = "",
failedOut = "",
merge = FALSE,
mergeOut = "",
phred64 = FALSE,
interleaved = FALSE,
fixMGIid = FALSE,
adapterTrimming = TRUE,
adapterSequenceRead1 = "auto",
adapterSequenceRead2 = "auto",
adapterFasta = "",
trimFrontRead1 = 0,
trimTailRead1 = 0,
trimFrontRead2 = 0,
trimTailRead2 = 0,
maxLengthRead1 = 0,
maxLengthRead2 = 0,
forceTrimPolyG = FALSE,
disableTrimPolyG = FALSE,
minLengthPolyG = 10,
trimPolyX = FALSE,
minLengthPolyX = 10,
cutWindowSize = 4,
cutLowQualTail = FALSE,
cutSlideWindowRight = FALSE,
cutLowQualFront = FALSE,
cutMeanQual = 20,
cutFrontWindowSize = 4,
cutFrontMeanQual = 20,
cutTailWindowSize = 4,
cutTailMeanQual = 20,
cutSlideWindowSize = 4,
cutSlideWindowQual = 20,
qualityFiltering = TRUE,
qualityFilterPhred = 15,
qualityFilterPercent = 40,
maxNfilter = 5,
averageQualFilter = 0,
lengthFiltering = TRUE,
minReadLength = 15,
maxReadLength = 0,
lowComplexityFiltering = FALSE,
minComplexity = 30,
index1Filter = "",
index2Filter = "",
maxIndexMismatch = 0,
correctionOverlap = FALSE,
minOverlapLength = 30,
maxOverlapMismatch = 5,
maxOverlapMismatchPercentage = 20,
umi = FALSE,
umiLoc = "",
umiLength = 0,
umiPrefix = "",
umiSkipBaseLength = 0,
umiNoConnection = FALSE,
umiIgnoreSeqNameSpace = FALSE,
overrepresentationAnalysis = FALSE,
overrepresentationSampling = 20,
splitOutput = 0,
splitByLines = 0,
thread = 2,
verbose = TRUE
)
_A_r_g_u_m_e_n_t_s:
read1: read1 input file name(s). [vector]
read2: read2 input file name(s). [vector]
outputFastq: string of /path/prefix for output fastq [string]
unpaired: for PE input, output file name for reads which the mate reads
failed to pass the QC [string], default NULL, discard it.
[string]
failedOut: file to store reads that cannot pass the filters default
NULL, discard it. [string]
merge: for PE input, A logical(1) indicating whether merge each pair
of reads into a single read if they are overlaped, unmerged
reads will be write to `output` file. Default is FALSE. the
`mergeOut` must be set if TRUE.
mergeOut: under `merge` mode, file to store the merged reads. [string]
phred64: A logical indicating whether the input is using phred64
scoring (it will be converted to phred33, so the output will
still be . phred33)
interleaved: A logical indicating whether <read1> is an interleaved
FASTQ which contains both read1 and read2. Default is FALSE.
fixMGIid: the MGI FASTQ ID format is not compatible with many BAM
operation tools, enable this option to fix it. Default is
FALSE
adapterTrimming: A logical indicating whether run adapter trimming.
Default is `TRUE`
adapterSequenceRead1: the adapter for read1. For SE data, if not
specified, the adapter will be auto-detected. For PE data,
this is used if R1/R2 are found not overlapped.
adapterSequenceRead2: the adapter for read2 (PE data only). This is
used if R1/R2 are found not overlapped. If not specified, it
will be the same as <adapterSequenceRead1>
adapterFasta: specify a FASTA file to trim both read1 and read2 (if PE)
by all the sequences in this FASTA file.
trimFrontRead1: trimming how many bases in front for read1, default is
0.
trimTailRead1: trimming how many bases in tail for read1, default is 0'
trimFrontRead2: trimming how many bases in front for read2. If it's not
specified, it will follow read1's settings
trimTailRead2: trimming how many bases in tail for read2. If it's not
specified, it will follow read1's settings
maxLengthRead1: if read1 is longer than maxLengthRead1, then trim read1
at its tail to make it as long as maxLengthRead1 Default 0
means no limitation.
maxLengthRead2: if read2 is longer than maxLengthRead2, then trim read2
at its tail to make it as long as maxLengthRead2. Default 0
means no limitation. If it's not specified, it will follow
read1's settings.
forceTrimPolyG: A logical indicating force polyG tail trimming,
trimming is only automatically enabled for Illumina
NextSeq/NovaSeq . data.
disableTrimPolyG: A logical indicating disable polyG tail trimming.
minLengthPolyG: the minimum length to detect polyG in the read tail. 10
by default.
trimPolyX: A logical indicating force polyX tail trimming.
minLengthPolyX: the minimum length to detect polyX in the read tail. 10
by default.
cutWindowSize: the window size option shared by cutLowQualFront,
cutLowQualTail, or cutSlideWindowRight. Range: 1~1000,
default: 4
cutLowQualTail: A logical indiccating move a sliding window from tail
(3') to front, drop the bases in the window if its mean
quality < threshold, stop otherwise. Default is `FALSE`
cutSlideWindowRight: A logical indicating move a sliding window from
front to tail, if meet one window with mean quality <
threshold, drop the bases in the window and the right part,
and then stop. Default is `FALSE`
cutLowQualFront: A logical indiccating move a sliding window from front
(5') to tail, drop the bases in the window if its mean
quality < threshold, stop otherwise. Default is `FALSE`
cutMeanQual: the mean quality requirement option shared by
cutLowQualFront, cutLowQualTail or cutSlideWindowRight.
Range: 1~36, default: 20
cutFrontWindowSize: the window size option of cutLowQualFront, default
to cutWindowSize if not specified. default: 4
cutFrontMeanQual: the mean quality requirement option for
cutLowQualFront, default to cutMeanQual if not specified.
default: 20
cutTailWindowSize: the window size option of cutLowQualTail, default to
cutWindowSize if not specified. default: 4
cutTailMeanQual: the mean quality requirement option for
cutLowQualTail, default to cutMeanQual if not specified.
default: 20
cutSlideWindowSize: the window size option of cutSlideWindowRight,
default to cutWindowSize if not specified. default: 4
cutSlideWindowQual: the mean quality requirement option for
cutSlideWindowRight, default to cutMeanQual if not specified.
default: 20
qualityFiltering: A logical indicating run quality filtering. Default
is `TRUE`.
qualityFilterPhred: the minimum quality value that a base is qualified.
Default 15 means phred quality >=Q15 is qualified.
qualityFilterPercent: Maximum percents of bases are allowed to be
unqualified (0~100). Default 40 means 40%
maxNfilter: maximum number of N allowed in the sequence. read/pair is
discarded if failed to pass this filter. Default is 5
averageQualFilter: if one read's average quality score <
`averageQualFilter`, then this read/pair is discarded.
Default 0 means no requirement.
lengthFiltering: A logical indicating whether run lenght filtering.
Default: TRUE
minReadLength: reads shorter than minReadLength will be discarded,
default is 15.
maxReadLength: reads longer than maxReadLength will be discarded,
default 0 means no limitation.
lowComplexityFiltering: A logical indicating whethere run low
complexity filter. The complexity is defined as the
percentage of base that is different from its next base
(base[i] != base[i+1]). Default is `FALSE`
minComplexity: the threshold for low complexity filter (0~100). Default
is 30, which means 30% complexity is required. (int [=30])
index1Filter: specify a file contains a list of barcodes of index1 to
be filtered out, one barcode per line.
index2Filter: specify a file contains a list of barcodes of index2 to
be filtered out, one barcode per line.
maxIndexMismatch: the allowed difference of index barcode for index
filtering, default 0 means completely identical.
correctionOverlap: A logical indicating run base correction in
overlapped regions (only for PE data), default is `FALSE`
minOverlapLength: the minimum length to detect overlapped region of PE
reads. This will affect overlap analysis based PE merge,
adapter trimming and correction. 30 by default.
maxOverlapMismatch: the maximum number of mismatched bases to detect
overlapped region of PE reads. This will affect overlap
analysis based PE merge, adapter trimming and correction. 5
by default.
maxOverlapMismatchPercentage: the maximum percentage of mismatched
bases to detect overlapped region of PE reads. This will
affect overlap analysis based PE merge, adapter trimming and
correction. Default 20 means 20%
umi: A logical indicating whethere preprocessing unique molecular
identifier (UMI). Default: `FALSE`
umiLoc: specify the location of UMI, can be
(index1/index2/read1/read2/per_index/per_read)
umiLength: length of UMI if the UMI is in read1/read2.
umiPrefix: an string indication the following string is UMI (i.e.
prefix=UMI, UMI=AATTCG, final=UMIAATTCG). Only letters,
numbers, and '#" allowed. No prefix by default.
umiSkipBaseLength: if the UMI is in read1/read2, skip
`umiSkipBaseLength` bases following UMI, default is 0.
umiNoConnection: an logical indicating remove "_" between the UMI
prefix string and the UMI string. Default is FALSE.
umiIgnoreSeqNameSpace: an logical indicating ignore the space in the
sequence name. Default is FALSE, the umi tag will be inserted
into the sequence name before the first SPACE.
overrepresentationAnalysis: A logical indicating overrepresentation
analysis. Default is `FALSE`
overrepresentationSampling: one in `overrepresentationSampling` reads
will be computed for overrepresentation analysis (1~10000),
smaller is slower, default is 20.
splitOutput: number of files to be splitted (2~999). a sequential
number prefix will be added to output name. Default is 0 (no
split)
splitByLines: split output by limiting lines of each file(>=1000), a
sequential number prefix will be added to output name (
0001.out.fq, 0002.out.fq...), default is 0 (disabled).
thread: owrker thread number, default is 2
verbose: output verbose log information
_V_a_l_u_e:
returns a json object of the report.
_A_u_t_h_o_r(_s):
Thomas Carroll, Wei Wang
_E_x_a_m_p_l_e_s:
# preprare for the input and output files.
# if the output file exists, it will be OVERWRITEN.
se_read1 <- system.file("extdata","Fox3_Std_small.fq.gz",package="Rfastp")
pe_read1 <- system.file("extdata","reads1.fastq.gz",package="Rfastp")
pe_read2 <- system.file("extdata","reads2.fastq.gz",package="Rfastp")
outputPrefix <- tempfile(tmpdir = tempdir())
# a normal single-end file
se_json_report <- rfastp(read1 = se_read1,
outputFastq=paste0(outputPrefix, "_se"), thread = 4)
# merge paired-end data by overlap:
pe_json_report <- rfastp(read1 = pe_read1, read2 = pe_read2, merge = TRUE,
outputFastq = paste0(outputPrefix, '_unpaired'),
mergeOut = paste0(outputPrefix, '_merged.fastq.gz'))
# a clipr example
clipr_json_report <- rfastp(read1 = se_read1,
outputFastq = paste0(outputPrefix, '_clipr'),
disableTrimPolyG = TRUE,
cutLowQualFront = TRUE,
cutFrontWindowSize = 29,
cutFrontMeanQual = 20,
cutLowQualTail = TRUE,
cutTailWindowSize = 1,
cutTailMeanQual = 5,
minReadLength = 29,
adapterSequenceRead1 = 'GTGTCAGTCACTTCCAGCGG'
)
catfastq package:Rfastp R Documentation
_C_o_n_c_a_t_e_n_a_t_e _F_a_s_t_q _F_i_l_e_s.
_D_e_s_c_r_i_p_t_i_o_n:
concatenate multiple fastq files into a single file.
_U_s_a_g_e:
catfastq(output, inputFiles, append = FALSE, paired = FALSE, shuffled = FALSE)
_A_r_g_u_m_e_n_t_s:
output: output file name [string]
inputFiles: a vector of input file names [vector]
append: a logical indicating append the files to a file already
exists.
paired: a logical indicating split the input files into two halves.
the first half merged into read1, the second half merged into
read2.
shuffled: a logical indicating split the input file list into two
halves. The R1/R2 files are inteleaved in the inputFiles
vector.
_V_a_l_u_e:
no returns.
_A_u_t_h_o_r(_s):
Wei Wang
_E_x_a_m_p_l_e_s:
pe001_read1 <- system.file("extdata","splited_001_R1.fastq.gz",
package="Rfastp")
pe002_read1 <- system.file("extdata","splited_002_R1.fastq.gz",
package="Rfastp")
pe003_read1 <- system.file("extdata","splited_003_R1.fastq.gz",
package="Rfastp")
pe004_read1 <- system.file("extdata","splited_004_R1.fastq.gz",
package="Rfastp")
pe001_read2 <- system.file("extdata","splited_001_R2.fastq.gz",
package="Rfastp")
pe002_read2 <- system.file("extdata","splited_002_R2.fastq.gz",
package="Rfastp")
pe003_read2 <- system.file("extdata","splited_003_R2.fastq.gz",
package="Rfastp")
pe004_read2 <- system.file("extdata","splited_004_R2.fastq.gz",
package="Rfastp")
allR1 <- c(pe001_read1, pe002_read1, pe003_read1, pe004_read1)
allR2 <- c(pe001_read2, pe002_read2, pe003_read2, pe004_read2)
allreads <- c(allR1, allR2)
allreads_shuffled <- c(pe001_read1, pe001_read2, pe002_read1, pe002_read2,
pe003_read1, pe003_read2, pe004_read1, pe004_read2)
outputPrefix <- tempfile(tmpdir = tempdir())
# a normal concatenation for single-end libraries.
catfastq(output = paste0(outputPrefix, "_R1.fastq.gz"), inputFiles = allR1)
# a normal concatenation for paired-end libraries.
catfastq(output = paste0(outputPrefix, "merged_paired"),
inputFiles = allreads, paired=TRUE)
# Append to exist files (paired-end)
catfastq(output=paste0(outputPrefix,"append_paired"), inputFiles=allreads,
append=TRUE, paired=TRUE)
# Input paired-end files are shuffled.
catfastq(output=paste0(outputPrefix,"_shuffled_paired"),
inputFiles=allreads_shuffled, paired=TRUE, shuffled=TRUE)
qcSummary package:Rfastp R Documentation
_S_u_m_m_a_r_y _o_f _F_a_s_t_q _Q_u_a_l_i_t_y _C_o_n_t_r_o_l
_D_e_s_c_r_i_p_t_i_o_n:
generate a data frame of the Fastq QC summary.
_U_s_a_g_e:
qcSummary(json)
_A_r_g_u_m_e_n_t_s:
json: the output json of function rfastq. [json]
_V_a_l_u_e:
a data frame.
_A_u_t_h_o_r(_s):
Wei Wang
_E_x_a_m_p_l_e_s:
outputPrefix <- tempfile(tmpdir = tempdir())
se_read1 <- system.file("extdata","Fox3_Std_small.fq.gz",package="Rfastp")
se_json_report <- rfastp(read1 = se_read1, outputFastq = outputPrefix,
thread = 4)
df_summary <- qcSummary(se_json_report)
trimSummary package:Rfastp R Documentation
_S_u_m_m_a_r_y _o_f _F_a_s_t_q _a_d_a_p_t_e_r _a_n_d _l_o_w _q_u_a_l_i_t_y _t_r_i_m_m_i_n_g
_D_e_s_c_r_i_p_t_i_o_n:
generate a data frame of the Fastq trim summary.
_U_s_a_g_e:
trimSummary(json)
_A_r_g_u_m_e_n_t_s:
json: the output json of function rfastq. [json]
_V_a_l_u_e:
a data frame.
_A_u_t_h_o_r(_s):
Wei Wang
_E_x_a_m_p_l_e_s:
outputPrefix <- tempfile(tmpdir = tempdir())
se_read1 <- system.file("extdata","Fox3_Std_small.fq.gz",package="Rfastp")
se_json_report <- rfastp(read1 = se_read1, outputFastq = outputPrefix,
thread = 4, adapterSequenceRead1 = 'GTGTCAGTCACTTCCAGCGG')
trim_summary <- trimSummary(se_json_report)
curvePlot package:Rfastp R Documentation
_P_l_o_t _o_f _B_a_s_e _Q_u_a_l_i_t_y _a_n_d _G_C _C_o_n_t_e_n_t.
_D_e_s_c_r_i_p_t_i_o_n:
generate a ggplot2 object of Base Quality/GC content before and
after QC.
_U_s_a_g_e:
curvePlot(json, curves = "quality_curves")
_A_r_g_u_m_e_n_t_s:
json: the output json of function rfastq. [json]
curves: plots for Base Quality("quality_curves") or GC
content("content_curves"). default is "quality_curves"
_V_a_l_u_e:
a ggplot2 object.
_A_u_t_h_o_r(_s):
Wei Wang
_E_x_a_m_p_l_e_s:
outputPrefix <- tempfile(tmpdir = tempdir())
se_read1 <- system.file("extdata","Fox3_Std_small.fq.gz",package="Rfastp")
se_json_report <- rfastp(read1 = se_read1, outputFastq = outputPrefix,
thread = 4)
# Base Quality plot is the default output:
p1 <- curvePlot(se_json_report)
p1
p2 <- curvePlot(se_json_report, curves = "content_curves")
Error running filter pandoc-citeproc:
Could not find executable pandoc-citeproc
Error: processing vignette 'Rfastp.Rmd' failed with diagnostics:
pandoc document conversion failed with error 83
--- failed re-building ‘Rfastp.Rmd’
SUMMARY: processing the following file failed:
‘Rfastp.Rmd’
Error: Vignette re-building failed.
Execution halted