The CRISPRseek (Zhu et al. 2014) package provides a range of funtions for identifying and analyzing guide RNAs (gRNAs) in CRISPR-based experiments. It generates detailed reports that include information on potential off-targets, restriction enzyme recognition sites, potential gRNA pairings for double nickases, and more.
CRISPRseek 1.53.0
CRISPR-Cas nucleases and their derivatives, such as nickases and gene expression regulators, have become the most popular tools for genome modification and gene expression regulation in both model organisms and human cells (Mali et al. 2013; Hsu et al. 2013). The CRISPR-Cas system uses a guide RNA (gRNA) to direct the Cas nuclease to target DNA sequence that is adjacent to a Protospace Adjacent Motif (PAM). The Cas enzyme then creates a double-strand break at the target site, initiating the gene modification. Following the cut, various editing outcomes, such as short insertions and deletions (INDELs) as well as point mutations, can occur through different DNA damage repair mechanisms (Chen et al. 2019). In the most widely used CRISPR system from Streptococcus pyogenes, the gRNA consists of 20 nucleotides, with the preferred PAM being “NGG” (or “NAG” with reduced activity).
A key limitation of CRISPR systems is their potential to cleave DNA sequences that do no perfectly match the gRNA target, known as “off-target effects”. Therefore, designing gRNAs with low off-target activity is crucial for the effective application of CRISPR systems (Zhu 2015). Several strategies can help minimize off-target effects:
We developed the CRISPRseek package to assist with all the above steps. Key features include:
The CRISPRseek package generates several reports. Key output includes:
The CRISPRseek package is highly flexible, allowing users to customize gRNA and PAM sequence requirements for different CRISPR systems across various bacterial species. It can also be easily extended to incorporate improved weight matrices or scoring methods for off-target analysis as new experimental and computational results emerge.
Key functions implemented in the CRISPRseek, along with their roles, input parameters, and outputs, are illustrated in the diagram below. For convenience, we highly recommend using the one-stop wrapper function, offtargetAnalysis(), which streamlines the entire gRNA identification and off-target analysis workflow.
Figure 1: Analytical workflow and core functions in CRISPRseek
In this section, we will demonstrate different gRNA design scenarios using the offtargetAnalysis() function. Some of its core parameters are described below. Type ?offtargetAnalysis for detailed description of all supported parameters.
DNAStringSet object containing sequences to be searched for potential gRNAs.inputFilePath. Set to FALSE if the input file already contains user-selected gRNAs plus PAM.BSgenome object containing the target genome sequence, used for off-target search.BSgenomeName. Specifies the path to a custom target genome file in FASTA format, used for off-target search. It is applicable when BSgenomeName is NOT set. When genomeSeqFile is set, the annotateExon, txdb, and orgAnn parameters will be ignored.TxDb object containing organism-specific annotation data, required for annotateExon.OrgDb object containing organism-specific annotation mapping information, required for annotateExon.To annotate the resulting off-targets to nearby exons, the following parameters are required: “annotateExon”, “BSgenomeName”, “txdb”, and “orgAnn”.
available.genomes() function in the BSgenome package. Common examples include BSgenome.Hsapiens.UCSC.hg19 (hg19), BSgenome.Hsapiens.UCSC.hg38 (hg38), BSgenome.Mmusculus.UCSC.mm10 (mm10), BSgenome.Celegans.UCSC.ce6 (ce6).TxDb objects, search for annotation packages starting with “TxDb” at Bioconductor. Examples include TxDb.Hsapiens.UCSC.hg19.knownGene (for hg19) and TxDb.Mmusculus.UCSC.mm10.knownGene (for mm10). To build custom TxDb, refer to the GenomicFeatures and txdbmaker packages.OrgDb packages, search for “OrgDb” at Bioconductor. Examples include org.Hs.eg.db (for human) and org.Mm.eg.db (for mouse).The offTargetAnalysis() function offers two input options:
By default, the parameter findgRNAs = TRUE directs the function to accept a sequence file (via inputFilePath), search for potential gRNAs, and then perform off-target analysis.
Alternatively, if you already have a list of user-designed gRNAs, you can provide them via inputFilePath as well, set findgRNAs = FALSE, and the function will perform off-target analysis without searching for gRNAs.
The following examples use a raw sequence as input and, therefore, set findgRNAs = TRUE.
By default, the offTargetAnalysis() function will identify all potential gRNAs in the given input sequence, perform off-target analysis, and annotate for all identified off-targets. This generates the most comprehensive reports, but comes with the trade-off of the slowest running time. Additionally, we need to load the necessary annotation packages first:
library(CRISPRseek)
library(BSgenome.Hsapiens.UCSC.hg38)
library(TxDb.Hsapiens.UCSC.hg38.knownGene)
library(org.Hs.eg.db)
Note that we set chromToSearch = "chrX" to restrict the off-target search to the “chrX” to speed up the analysis.
inputFilePath <- system.file('extdata', 'inputseq.fa', package = 'CRISPRseek')
outputDir <- getwd()
res <- offTargetAnalysis(inputFilePath = inputFilePath,
BSgenomeName = Hsapiens,
chromToSearch= "chrX",
# Annotation packages required for annotation.
txdb = TxDb.Hsapiens.UCSC.hg38.knownGene,
orgAnn = org.Hs.egSYMBOL,
outputDir = outputDir,
overwrite = TRUE)
head(res$summary[, c("names", "gRNAsPlusPAM", "gRNAefficacy")])
## names gRNAsPlusPAM gRNAefficacy
## 1 Hsap_GATA1_ex2_gR17f CCAGTTTGTGGATCCTGCTCNGG 0.10654794
## 2 Hsap_GATA1_ex2_gR20r GGTGTGGAGGACACCAGAGCNGG 0.14209108
## 3 Hsap_GATA1_ex2_gR39f GTGTCCTCCACACCAGAATCNGG 0.06962952
## 4 Hsap_GATA1_ex2_gR40f TGTCCTCCACACCAGAATCANGG 0.26188176
## 5 Hsap_GATA1_ex2_gR7r CCAGAGCAGGATCCACAAACNGG 0.10171983
head(res$offtarget[, c("name", "OffTargetSequence", "alignment", "score", "gRNAefficacy")])
## name OffTargetSequence alignment score
## 81 Hsap_GATA1_ex2_gR40f TGTCCTTGACACAAGAATCATGT ......TG....A....... 0.7
## 171 Hsap_GATA1_ex2_gR20r GGTCTGGAGGACAGCACAGCCTG ...C.........G..C... 0.2
## 191 Hsap_GATA1_ex2_gR20r TGTGTGTAGGACTCCAGAGCAAG T.....T.....T....... 0.8
## 16 Hsap_GATA1_ex2_gR20r GGTGTGGAGGAGATGAGAGCATG ...........G.TG..... 0.0
## 23 Hsap_GATA1_ex2_gR7r CCAGAGCAGGATCCACAAACTGG .................... 100.0
## 9 Hsap_GATA1_ex2_gR40f TGTCCTCCACACCAGAATCAGGG .................... 100.0
## gRNAefficacy
## 81 0.2068879
## 171 0.2487753
## 191 0.1297587
## 16 0.1521223
## 23 0.1017198
## 9 0.2618818
To skip the annotation step, simply set annotateExon = FALSE:
res <- offTargetAnalysis(inputFilePath = inputFilePath,
BSgenomeName = Hsapiens,
annotateExon = FALSE,
chromToSearch = "chrX",
outputDir = outputDir,
overwrite = TRUE)
For a quicker gRNA search, you can call the function with chromToSearch = "", which disables the search of identified gRNAs against the reference genome. This will significantly reduce the running time.
res <- offTargetAnalysis(inputFilePath = inputFilePath,
BSgenomeName = Hsapiens, # optional
chromToSearch = "",
outputDir = outputDir,
overwrite = TRUE)
res
## DNAStringSet object of length 5:
## width seq names
## [1] 23 CCAGTTTGTGGATCCTGCTCTGG Hsap_GATA1_ex2_gR17f
## [2] 23 GTGTCCTCCACACCAGAATCAGG Hsap_GATA1_ex2_gR39f
## [3] 23 TGTCCTCCACACCAGAATCAGGG Hsap_GATA1_ex2_gR40f
## [4] 23 GGTGTGGAGGACACCAGAGCAGG Hsap_GATA1_ex2_gR20r
## [5] 23 CCAGAGCAGGATCCACAAACTGG Hsap_GATA1_ex2_gR7r
Note that setting chromToSearch = "" also disables the calculation of gRNA efficacy, which measures how effectively a gRNA facilitates cleavage at the target site. To enable the calculation of gRNA efficacy at the on-target site, specify the chromosome where the on-targets are located (e.g., chromToSearch = "chrX") and set max.mismatch = 0 to ensure no off-target analysis is performed.
res <- offTargetAnalysis(inputFilePath = inputFilePath,
BSgenomeName = Hsapiens,
annotateExon = FALSE,
chromToSearch = "chrX",
max.mismatch = 0,
outputDir = outputDir,
overwrite = TRUE)
head(res$summary[, c("names", "gRNAsPlusPAM", "gRNAefficacy")])
## names gRNAsPlusPAM gRNAefficacy
## 1 Hsap_GATA1_ex2_gR17f CCAGTTTGTGGATCCTGCTCNGG 0.10654794
## 2 Hsap_GATA1_ex2_gR20r GGTGTGGAGGACACCAGAGCNGG 0.14209108
## 3 Hsap_GATA1_ex2_gR39f GTGTCCTCCACACCAGAATCNGG 0.06962952
## 4 Hsap_GATA1_ex2_gR40f TGTCCTCCACACCAGAATCANGG 0.26188176
## 5 Hsap_GATA1_ex2_gR7r CCAGAGCAGGATCCACAAACNGG 0.10171983
Four rule sets are currently supported for calculating gRNA efficacy (rule.set = c("Root_RuleSet1_2014", "Root_RuleSet2_2016", "CRISPRscan", "DeepCpf1")) (Doench et al. 2014, 2016; Moreno-Mateos et al. 2015; Kim et al. 2018). By default, “Root_RuleSet_2014” is be used. To use “Root_RuleSet2_2016”, first install python 2.7 via Anaconda (As RuleSet2 is implemented with python 2.7), then install the following Python packages: scikit-learn 0.16.1, pickle, pandas, numpy, and scipy. Afterward, in an R session, run the following commands:
Sys.setenv(PATH = paste("/anaconda2/bin", Sys.getenv("PATH"), sep = ":"))
system("python --version") # Should output Python 2.7.15.
If rule.set = "CRISPRscan", must also specify the corresponding parameters for baseBefroegRNA, baseAfterPAM, and featureWeightMatrixFile to ensure correct efficacy calculation:
m <- system.file("extdata", "Morenos-Mateo.csv", package = "CRISPRseek")
res <- offTargetAnalysis(inputFilePath = inputFilePath,
BSgenomeName = Hsapiens,
annotateExon = FALSE,
chromToSearch = "chrX",
max.mismatch = 0,
rule.set = "CRISPRscan",
baseBeforegRNA = 6,
baseAfterPAM = 6,
featureWeightMatrixFile = m,
outputDir = outputDir,
overwrite = TRUE)
If you would like to search for off-targets in custom reference genomes (rather than using a BSgenome), you can specify the path to the custom reference sequence file via the genomeSeqFile argument. Please note that, when a custom reference is used, arguments annotateExon, BSgenomeName, txdb, and fetchSequence will be ignored.
inputFilePath2 <- system.file("extdata", "inputseqWithoutBSgenome.fa", package = "CRISPRseek")
genomeSeqFile <- system.file("extdata", "genomeSeq.fasta", package = "CRISPRseek")
res <- offTargetAnalysis(inputFilePath = inputFilePath2,
genomeSeqFile = genomeSeqFile,
outputDir = outputDir,
overwrite = TRUE)
head(res$summary)
The CRISPRseek supports searching for off-targets with bulges (both RNA bulges and DNA bulges) by integrating the Cas-OFFinder (Bae, Park, and Kim 2014) tool. To enable this, you can call the master function offTargetAnalysis() with the argument findOffTargetsWithBulge = TRUE.
There are three parameters specific to bulge searches, with the following default values:
method.findOffTargetsWithBulge = "CasOFFinder_v3.0.0b3"DNA_bulge = 2RNA_bulge = 2Note that, currently, method.findOffTargetsWithBulge only supports “CasOFFinder_v3.0.0b3”, which generates results that may differ from those produced by “CasOFFinder_v2”, For more details, refer to this link. To use “CasOFFinder” on Linux or Windows, you may need to install “pocl-opencl-icd” if it is not already installed.
if (interactive()) {
res <- offTargetAnalysis(inputFilePath = inputFilePath,
findOffTargetsWithBulge = TRUE,
BSgenomeName = Hsapiens,
chromToSearch = "chrX",
annotateExon = FALSE,
outputDir = outputDir,
overwrite = TRUE)
head(res$offtarget[, c("name", "gRNAPlusPAM_bulge", "OffTargetSequence_bulge", "n.RNABulge", "n.DNABulge", "alignment")])
}
The columns relevant to the bulge search are described below. If no bulge is detected, both the “gRNAPlusPAM_bulge” and “OffTargetSequence_bulge” columns for that row will both be empty, while the “n.RNABulge” and “n.DNABulge” values will both be 0.
Alternatively, you can use the wrapper function getOfftargetWithBulge() to directly output the Cas-OFFinder results. The function accepts input in the form of either a DNAStringSet object from findgRNA(), or a list object from offTargetAnalysis().
Note that getOfftargetWithBulge() currently supports two versions of Cas-OFFinder: “2.4.1” and “3.0.0b3”, specified through the cas_offinder_version argument, with the default set to “2.4.1”. Type ?getOfftargetWithBulges for more examples.
if (interactive()) {
gRNA_PAM <- findgRNAs(inputFilePath = system.file("extdata",
"inputseq.fa",
package = "CRISPRseek"),
pairOutputFile = "testpairedgRNAs.xls",
findPairedgRNAOnly = TRUE)
res <- getOfftargetWithBulge(gRNA_PAM,
BSgenomeName = Hsapiens,
chromToSearch = "chrX")
head(res)
}
The scoring.method argument in offTargetAnalysis() determines how off-target scores are calculated. By default, scoring.method = "Hsu-Zhuang", which models the effect of mismatch position on cutting frequency. To account for both mismatch position and type, you can switch to using the CFD score (Doench et al. 2016). To enable this, set scoring.method = "CFDscore" and PAM.pattern = "NNG$|NGN$".
res <- offTargetAnalysis(inputFilePath = inputFilePath,
BSgenomeName = Hsapiens,
chromToSearch = "chrX",
annotateExon = FALSE,
scoring.method = "CFDscore",
PAM.pattern = "NNG$|NGN$",
outputDir = outputDir,
overwrite = TRUE)
head(res$offtarget[, c("name", "gRNAPlusPAM", "score", "alignment")])
## name gRNAPlusPAM score alignment
## 23 Hsap_GATA1_ex2_gR7r CCAGAGCAGGATCCACAAACNGG 1.000000 ....................
## 22 Hsap_GATA1_ex2_gR7r CCAGAGCAGGATCCACAAACNGG 0.032997 ....T.......T....T..
## 9 Hsap_GATA1_ex2_gR40f TGTCCTCCACACCAGAATCANGG 1.000000 ....................
## 14 Hsap_GATA1_ex2_gR40f TGTCCTCCACACCAGAATCANGG 0.022774 G...A...T...........
## 10 Hsap_GATA1_ex2_gR40f TGTCCTCCACACCAGAATCANGG 0.022096 ....T......AT.......
## 13 Hsap_GATA1_ex2_gR40f TGTCCTCCACACCAGAATCANGG 0.021065 .......A..........G.
You can filter the output to include only the desired gRNAs, such as paired gRNAs or those with specific restriction enzyme recognition sites, by adjusting the following parameters.
findPairedgRNAOnly = FALSE:
min.gap (defaults to 0) and max.gap (defaults to 20), inclusive. And the reverse gRNA must be positioned before the forward gRNA.findgRNAsWithREcutOnly = FALSE:
REpatternFile parameter to specify the file containing the restriction enzyme recognition patterns.Both parameters can be set to TRUE simultaneously to report only paired gRNAs, where at least one gRNA in the pair overlaps with a restriction enzyme recognition site.
res <- offTargetAnalysis(inputFilePath = inputFilePath,
BSgenomeName = Hsapiens,
annotateExon = FALSE,
chromToSearch = "chrX",
findPairedgRNAOnly = TRUE,
findgRNAsWithREcutOnly = TRUE,
outputDir = outputDir,
overwrite = TRUE)
head(res$summary[, c("names", "gRNAsPlusPAM", "gRNAefficacy", "PairedgRNAName", "REname")])
## names gRNAsPlusPAM gRNAefficacy
## 1 Hsap_GATA1_ex2_gR39f GTGTCCTCCACACCAGAATCNGG 0.06962952
## 2 Hsap_GATA1_ex2_gR40f TGTCCTCCACACCAGAATCANGG 0.26188176
## 3 Hsap_GATA1_ex2_gR7r CCAGAGCAGGATCCACAAACNGG 0.10171983
## PairedgRNAName REname
## 1 Hsap_GATA1_ex2_gR7r BslI HinfI TfiI
## 2 Hsap_GATA1_ex2_gR7r BslI HinfI TfiI
## 3 Hsap_GATA1_ex2_gR39f Hsap_GATA1_ex2_gR40f BslI PflMI
Searching for gRNAs in long input sequences (> 200 kb) may be slow. To improve performance, set annotatePaired = FALSE, and enable multicore processing by setting enable.multicore = TRUE and adjusting n.cores.max. Additionally, we recommend splitting very long sequences into smaller chunks and analyzing each sub-sequence separately. Special thanks to Alex Williams for sharing this use case. Finally, please ensure that repeat-masked sequences are used as input.
To identify gRNAs that preferentially target one allele, the function compare2Sequences(), which takes two input files, can be used. In the following example, file “rs362331C.fa” and “rs362331T.fa” represent two input files that contain sequences differing by a single nucleotide polymorphism (SNP). The results are saved in the file “scoresFor2InputSequences.xlsx”. The output file lists all possible gRNA sequences for each of the two input files and provides a cleavage score for each of the two input sequences. To preferentially target one allele, select gRNA sequences that have the lowest score for the other allele. Selected gRNAs can then by examined for off-targets using offTargetAnalysis() function with findgRNAs = FALSE as described above.
inputFile1Path <- system.file("extdata", "rs362331C.fa", package="CRISPRseek")
inputFile2Path <- system.file("extdata", "rs362331T.fa", package="CRISPRseek")
res <- compare2Sequences(inputFile1Path,
inputFile2Path,
outputDir = outputDir,
overwrite = TRUE)
## search for gRNAs for input file1...
## search for gRNAs for input file2...
## [1] "Scoring ..."
## finish off-target search in sequence 2
## finish off-target search in sequence 1
## finish feature vector building
## finish score calculation
## [1] "Done!"
head(res[, c("name", "gRNAPlusPAM", "scoreForSeq1", "scoreForSeq2", "gRNAefficacy", "scoreDiff")])
## name gRNAPlusPAM scoreForSeq1 scoreForSeq2
## 10 rs362331C_gR22r TGAAGTGCACACAGTGGATGNGG 100 17.2
## 11 rs362331C_gR21r GAAGTGCACACAGTGGATGANGG 100 26.8
## 12 rs362331C_gR15r CACACAGTGGATGAGGGAGCNGG 100 61.1
## 7 rs362331C_gR9r GTGGATGAGGGAGCAGGCGTNGG 100 98.6
## 2 rs362331T_gR38f CTACTGTGTGCACTTCATCCNGG 100 100
## 6 rs362331T_gR10r AGTAGATGAGGGAGCAGGCGNGG 100 100
## gRNAefficacy scoreDiff
## 10 0.0978516718170484 82.8
## 11 0.129816665166513 73.2
## 12 0.0169291602963948 38.9
## 7 extended sequence too short 1.4
## 2 extended sequence too short 0.0
## 6 0.161377523263354 0.0
Cytosine base editors (CBEs) and adenine base editors (ABEs) can introduce specific DNA C-to-T or A-to-G alterations, respectively (Gaudelli et al. 2017; Komor et al. 2016). The offTargetAnalsys() can design gRNAs optimized for base editing by setting baseEditing = TRUE. In this case, the following parameters must also be specified (defaults are for the CBE system developed in the Liu Lab): targetBase = "C", editingWindow = 4:8, editingWindow.offtarget = 4:8.
res <- offTargetAnalysis(inputFilePath = inputFilePath,
chromToSearch = "",
baseEditing = TRUE,
targetBase = "C",
editingWindow = 4:8,
editingWindow.offtargets = 4:8,
outputDir = outputDir,
overwrite = TRUE)
res
## DNAStringSet object of length 1:
## width seq names
## [1] 23 CCAGAGCAGGATCCACAAACTGG Hsap_GATA1_ex2_gR7r
In addition to CBE, the Liu Lab also developed the prime editor (PE) (Anzalone et al. 2019), which is more versatile and flexible with high efficacy and without the need to make a DSB or providing donor template. It can be used to make all possible 12 single base changes, 1-44 bp insertions, or 1-80 bp deletions. This editing system can be programmed to correct about 89 percent of human pathogenic variants.
To design gRNAs and pegRNAs for PE, set primeEditing = TRUE together with the following parameters:
Type ?offTargetAnalysis for detailed description of each of these parameters.
inputFilePath <- DNAStringSet("CCAGTTTGTGGATCCTGCTCTGGTGTCCTCCACACCAGAATCAGGGATCGAAAACTCATCAGTCGATGCGAGTCATCTAAATTCCGATCAATTTCACACTTTAAACG")
res <- offTargetAnalysis(inputFilePath,
chromToSearch = "",
gRNAoutputName = "testPEgRNAs", # Required when inputFilePath is a DNAStringSet object.
primeEditing = TRUE,
targeted.seq.length.change = 0,
bp.after.target.end = 15,
PBS.length = 15,
RT.template.length = 8:30,
RT.template.pattern = "D$",
target.start = 20,
target.end = 20,
corrected.seq = "T",
findPairedgRNAOnly = TRUE,
paired.orientation = "PAMin",
outputDir = outputDir,
overwrite = TRUE)
res
## DNAStringSet object of length 4:
## width seq names
## [1] 23 CCAGTTTGTGGATCCTGCTCTGG NA_gR17f
## [2] 23 GAGTTTTCGATCCCTGATTCTGG NA_gR41r
## [3] 23 TTCGATCCCTGATTCTGGTGTGG NA_gR36r
## [4] 23 GATCCCTGATTCTGGTGTGGAGG NA_gR33r
For questions related to usage, please search/post your queries on the Bioconductor Support Site. If you wish to report a bug or request a new feature, kindly raise an issue on the CRISPRseek GitHub repository.
Yes, starting from version 1.44.1, CRISPRseek supports the detection of off-targets with bulges by integrating Cas-OFFinder (Bae, Park, and Kim 2014). To learn more, type ?getOfftargetWithBulge and ?offTargetAnalysis for detailed documentation.
If you use CRISPRseek in your work, please cite it as follows:
citation(package = "CRISPRseek")
## Please cite the paper below for the CRISPRseek package.
##
## Zhu LJ, Holmes BR, Aronin N, Brodsky MH (2014) CRISPRseek: A
## Bioconductor Package to Identify Target-Specific Guide RNAs for
## CRISPR-Cas9 Genome-Editing Systems. PLoS ONE 9(9): e108424.
## doi:10.1371/journal.pone.0108424
##
## Lihua Julie Zhu (2015). Overview of guide RNA design tools for
## CRISPR-Cas9 genome editing technology. Front. Biol., 10(4): 289-296
##
## To see these entries in BibTeX format, use 'print(<citation>,
## bibtex=TRUE)', 'toBibtex(.)', or set
## 'options(citation.bibtex.max=999)'.
Here is the output of sessionInfo() on the system on which this document was compiled running pandoc 2.7.3:
## R version 4.6.0 RC (2026-04-17 r89917)
## Platform: x86_64-pc-linux-gnu
## Running under: Ubuntu 24.04.4 LTS
##
## Matrix products: default
## BLAS: /home/biocbuild/bbs-3.24-bioc/R/lib/libRblas.so
## LAPACK: /usr/lib/x86_64-linux-gnu/lapack/liblapack.so.3.12.0 LAPACK version 3.12.0
##
## locale:
## [1] LC_CTYPE=en_US.UTF-8 LC_NUMERIC=C
## [3] LC_TIME=en_GB LC_COLLATE=C
## [5] LC_MONETARY=en_US.UTF-8 LC_MESSAGES=en_US.UTF-8
## [7] LC_PAPER=en_US.UTF-8 LC_NAME=C
## [9] LC_ADDRESS=C LC_TELEPHONE=C
## [11] LC_MEASUREMENT=en_US.UTF-8 LC_IDENTIFICATION=C
##
## time zone: America/New_York
## tzcode source: system (glibc)
##
## attached base packages:
## [1] stats4 stats graphics grDevices utils datasets methods
## [8] base
##
## other attached packages:
## [1] org.Hs.eg.db_3.23.1
## [2] TxDb.Hsapiens.UCSC.hg38.knownGene_3.22.0
## [3] BSgenome.Hsapiens.UCSC.hg38_1.4.5
## [4] BSgenome_1.81.0
## [5] rtracklayer_1.73.0
## [6] BiocIO_1.23.0
## [7] GenomeInfoDb_1.49.0
## [8] CRISPRseek_1.53.0
## [9] GenomicFeatures_1.65.0
## [10] AnnotationDbi_1.75.0
## [11] Biobase_2.73.0
## [12] GenomicRanges_1.65.0
## [13] Biostrings_2.81.0
## [14] Seqinfo_1.3.0
## [15] XVector_0.53.0
## [16] IRanges_2.47.0
## [17] S4Vectors_0.51.0
## [18] BiocGenerics_0.59.0
## [19] generics_0.1.4
## [20] BiocFileCache_3.3.0
## [21] dbplyr_2.5.2
## [22] BiocStyle_2.41.0
##
## loaded via a namespace (and not attached):
## [1] DBI_1.3.0 bitops_1.0-9
## [3] httr2_1.2.2 rlang_1.2.0
## [5] magrittr_2.0.5 ade4_1.7-24
## [7] rio_1.3.0 otel_0.2.0
## [9] matrixStats_1.5.0 compiler_4.6.0
## [11] RSQLite_2.4.6 png_0.1-9
## [13] vctrs_0.7.3 stringr_1.6.0
## [15] pkgconfig_2.0.3 crayon_1.5.3
## [17] fastmap_1.2.0 Rsamtools_2.29.0
## [19] rmarkdown_2.31 UCSC.utils_1.9.0
## [21] purrr_1.2.2 bit_4.6.0
## [23] xfun_0.57 cachem_1.1.0
## [25] cigarillo_1.3.0 seqinr_4.2-44
## [27] jsonlite_2.0.0 blob_1.3.0
## [29] rhdf5filters_1.25.0 keras_2.16.1
## [31] DelayedArray_0.39.0 Rhdf5lib_2.1.0
## [33] BiocParallel_1.47.0 parallel_4.6.0
## [35] tensorflow_2.20.0 R6_2.6.1
## [37] bslib_0.10.0 stringi_1.8.7
## [39] reticulate_1.46.0 jquerylib_0.1.4
## [41] Rcpp_1.1.1-1.1 bookdown_0.46
## [43] SummarizedExperiment_1.43.0 knitr_1.51
## [45] base64enc_0.1-6 Matrix_1.7-5
## [47] tidyselect_1.2.1 abind_1.4-8
## [49] yaml_2.3.12 codetools_0.2-20
## [51] curl_7.1.0 lattice_0.22-9
## [53] tibble_3.3.1 withr_3.0.2
## [55] KEGGREST_1.53.0 evaluate_1.0.5
## [57] zip_2.3.3 pillar_1.11.1
## [59] BiocManager_1.30.27 filelock_1.0.3
## [61] MatrixGenerics_1.25.0 whisker_0.4.1
## [63] RCurl_1.98-1.18 gtools_3.9.5
## [65] glue_1.8.1 mltools_0.3.5
## [67] tools_4.6.0 data.table_1.18.2.1
## [69] openxlsx_4.2.8.1 GenomicAlignments_1.49.0
## [71] XML_3.99-0.23 rhdf5_2.57.0
## [73] grid_4.6.0 restfulr_0.0.16
## [75] cli_3.6.6 rappdirs_0.3.4
## [77] tfruns_1.5.4 S4Arrays_1.13.0
## [79] dplyr_1.2.1 hash_2.2.6.4
## [81] zeallot_0.2.0 sass_0.4.10
## [83] digest_0.6.39 SparseArray_1.13.0
## [85] rjson_0.2.23 memoise_2.0.1
## [87] htmltools_0.5.9 lifecycle_1.0.5
## [89] httr_1.4.8 bit64_4.8.0
## [91] MASS_7.3-65
Anzalone, A. V., P. B. Randolph, J. R. Davis, A. A. Sousa, L. W. Koblan, J. M. Levy, P. J. Chen, et al. 2019. “Search-and-Replace Genome Editing Without Double-Strand Breaks or Donor Dna.” Journal Article. Nature 576 (7785): 149–57. https://doi.org/10.1038/s41586-019-1711-4.
Bae, S., J. Park, and J. S. Kim. 2014. “Cas-Offinder: A Fast and Versatile Algorithm That Searches for Potential Off-Target Sites of Cas9 Rna-Guided Endonucleases.” Journal Article. Bioinformatics 30 (10): 1473–5. https://doi.org/10.1093/bioinformatics/btu048.
Chen, W., A. McKenna, J. Schreiber, M. Haeussler, Y. Yin, V. Agarwal, W. S. Noble, and J. Shendure. 2019. “Massively Parallel Profiling and Predictive Modeling of the Outcomes of Crispr/Cas9-Mediated Double-Strand Break Repair.” Journal Article. Nucleic Acids Res 47 (15): 7989–8003. https://doi.org/10.1093/nar/gkz487.
Doench, J. G., N. Fusi, M. Sullender, M. Hegde, E. W. Vaimberg, K. F. Donovan, I. Smith, et al. 2016. “Optimized sgRNA Design to Maximize Activity and Minimize Off-Target Effects of Crispr-Cas9.” Journal Article. Nat Biotechnol 34 (2): 184–91. https://doi.org/10.1038/nbt.3437.
Doench, J. G., E. Hartenian, D. B. Graham, Z. Tothova, M. Hegde, I. Smith, M. Sullender, B. L. Ebert, R. J. Xavier, and D. E. Root. 2014. “Rational Design of Highly Active sgRNAs for Crispr-Cas9-Mediated Gene Inactivation.” Journal Article. Nat Biotechnol 32 (12): 1262–7. https://doi.org/10.1038/nbt.3026.
Gaudelli, N. M., A. C. Komor, H. A. Rees, M. S. Packer, A. H. Badran, D. I. Bryson, and D. R. Liu. 2017. “Programmable Base Editing of a*T to G*C in Genomic Dna Without Dna Cleavage.” Journal Article. Nature 551 (7681): 464–71. https://doi.org/10.1038/nature24644.
Hsu, P. D., D. A. Scott, J. A. Weinstein, F. A. Ran, S. Konermann, V. Agarwala, Y. Li, et al. 2013. “DNA Targeting Specificity of Rna-Guided Cas9 Nucleases.” Journal Article. Nat Biotechnol 31 (9): 827–32. https://doi.org/10.1038/nbt.2647.
Kim, H. K., S. Min, M. Song, S. Jung, J. W. Choi, Y. Kim, S. Lee, S. Yoon, and H. H. Kim. 2018. “Deep Learning Improves Prediction of Crispr-Cpf1 Guide Rna Activity.” Journal Article. Nat Biotechnol 36 (3): 239–41. https://doi.org/10.1038/nbt.4061.
Komor, A. C., Y. B. Kim, M. S. Packer, J. A. Zuris, and D. R. Liu. 2016. “Programmable Editing of a Target Base in Genomic Dna Without Double-Stranded Dna Cleavage.” Journal Article. Nature 533 (7603): 420–4. https://doi.org/10.1038/nature17946.
Mali, P., J. Aach, P. B. Stranges, K. M. Esvelt, M. Moosburner, S. Kosuri, L. Yang, and G. M. Church. 2013. “CAS9 Transcriptional Activators for Target Specificity Screening and Paired Nickases for Cooperative Genome Engineering.” Journal Article. Nat Biotechnol 31 (9): 833–8. https://doi.org/10.1038/nbt.2675.
Moreno-Mateos, M. A., C. E. Vejnar, J. D. Beaudoin, J. P. Fernandez, E. K. Mis, M. K. Khokha, and A. J. Giraldez. 2015. “CRISPRscan: Designing Highly Efficient sgRNAs for Crispr-Cas9 Targeting in Vivo.” Journal Article. Nat Methods 12 (10): 982–8. https://doi.org/10.1038/nmeth.3543.
Zhu, Lihua Julie. 2015. “Overview of Guide Rna Design Tools for Crispr-Cas9 Genome Editing Technology.” Journal Article. Frontiers in Biology 10 (4): 289–96. https://doi.org/10.1007/s11515-015-1366-y.
Zhu, L. J., B. R. Holmes, N. Aronin, and M. H. Brodsky. 2014. “CRISPRseek: A Bioconductor Package to Identify Target-Specific Guide Rnas for Crispr-Cas9 Genome-Editing Systems.” Journal Article. PLoS One 9 (9): e108424. https://doi.org/10.1371/journal.pone.0108424.