\name{complementSeq}
\alias{complementSeq}

\title{Complementary sequence.}
\description{Function to obtain the complementary sequence.}
\usage{
complementSeq(seq, start=1, stop=0)
}
\arguments{
  \item{seq}{Character vector consisting of the letters A, C, G and T.}
  \item{start}{Numeric scalar: the sequence position at which to start
    complementing. If 1, start from the beginning.}
  \item{stop}{Numeric scalar: the sequence position at which to stop
    complementing. If 0, go until the end.}
}
\details{
  The complemented sequence for each element of the input is computed and
  returned.  The complement is given by the mapping:
  A -> T, C -> G, G -> C, T -> A.

  An important special case is \code{start=13}, \code{stop=13}:
  If \code{seq} is a vector of 25mer sequences on an Affymetrix
  GeneChip, \code{complementSeq(seq, start=13, stop=13)}
  calculates the so-called \emph{mismatch} sequences.

  The function deals only with sequences that represent DNA.
  These can consist only of the letters  \code{A}, \code{C}, \code{T}
  or \code{G}. Upper, lower or mixed case is allowed and honored.
  
}
\value{
  A character vector of the same length as \code{seq} is
  returned. Each component represents the transformed sequence for the
  input value.
}

\author{R. Gentleman, W. Huber}

\seealso{\code{\link{basecontent}}, \code{\link{reverseSeq}}}

\examples{
 seq <- c("AAACT", "GGGTT")
 complementSeq(seq)

 seq <- c("CGACTGAGACCAAGACCTACAACAG", "CCCGCATCATCTTTCCTGTGCTCTT")
 complementSeq(seq, start=13, stop=13)
}
\keyword{manip}