% \VignetteEngine{knitr::knitr}
% \VignetteIndexEntry{03. Sequence Analysis -- slides}

\documentclass[xcolor=dvipsnames]{beamer}

\usepackage{BioconductorSlides}
\hypersetup{colorlinks,linkcolor=,urlcolor=Blue}

\title{\Bioconductor{} for Sequence Analysis}
\author{Martin T.\ Morgan\footnote{\url{mtmorgan@fhcrc.org}}}
\date{27-28 February 2014}

\begin{document}

\maketitle

\begin{frame}[fragile]{Sequencing: Work flows}
  \begin{columns}
    \column{.5\textwidth}
    \begin{enumerate}
    \item Experimental design
    \item `Wet lab' sample prep
    \item Sequencing
        \begin{itemize}
        \item 100's of millions of reads
        \item 30-150 nucleotides
        \item Single and paired-end
        \item Bar codes, lanes \& flow cells
        \end{itemize}
    \item Alignment
    \item Analysis: DNA, RNA, epigenetics, integrative, microbiome,
      \ldots
    \end{enumerate}
    \column{.5\textwidth}
    \includegraphics[width=\textwidth,height=!]{figures/Solexa-bridge-pcr.jpg}
    \par Bentley et al., 2008, Nature 456:
    \href{http://www.ncbi.nlm.nih.gov/pubmed/18987734}{53-9}
  \end{columns}
\end{frame}

\begin{frame}{Experimental design and wet lab}
  \begin{itemize}
  \item RNA-seq
    \begin{itemize}
    \item Known gene / transcript diffential expression
    \item Novel transcript discovery
    \item Single- versus paired-end
    \end{itemize}
  \item ChIP-seq
  \item Variants
    \begin{itemize}
    \item Germline vs.\ somatic
    \item Exome vs.\ whole genome
    \item SNP vs.\ indel vs.\ structural
    \end{itemize}
  \item Copy number
    \begin{itemize}
    \item Low vs.\ high coverage
    \end{itemize}
  \end{itemize}
\end{frame}

\begin{frame}{RNA-seq: single versus paired end}
  \begin{itemize}
  \item Most analysis now paired-end
  \item Reads within exons
  \item A single end spanning exons: `junction reads'
  \item Reads spanning exons
  \end{itemize}
\end{frame}

{\scriptsize\begin{verbatim}
@ERR127302.1703 HWI-EAS350_0441:1:1:1460:19184#0/1
CCTGAGTGAAGCTGATCTTGATCTACGAAGAGAGATAGATCTTGATCGTCGAGGAGATGCTGACCTTGACCT
+
HHGHHGHHHHHHHHDGG<GDGGE@GDGGD<?B8??ADAD<BE@EE8EGDGA3CB85*,77@>>CE?=896=:
@ERR127302.1704 HWI-EAS350_0441:1:1:1460:16861#0/1
GCGGTATGCTGGAAGGTGCTCGAATGGAGAGCGCCAGCGCCCCGGCGCTGAGCCGCAGCCTCAGGTCCGCCC
+
DE?DD>ED4>EEE>DE8EEEDE8B?EB<@3;BA79?,881B?@73;1?########################
@ERR127302.1705 HWI-EAS350_0441:1:1:1460:13054#0/1
AAAACACCCTGCAATCTTTCAGACAGGATGTTGACAATGCGTCTCTGGCACGTCTTGACCTTGAACGCAAAG
+
EEDEE>AD>BBGGB8E8EEEGBGGGGBGGGGG3G>E3*?BE??BBC8GB8??:??GGDGDDD>D>B<GDDC8
@ERR127302.1706 HWI-EAS350_0441:1:1:1460:14924#0/1
CACCCAGTGGGGTGGAGTCGGAGCCACTGGTCCTGCTGCTGGCTGCCTCTCTGCTCCACCTTGTGACCCAGG
+
HHHHHGEEGEEADDGDBG>GGD8EG,<6<?AGGADFEHHC@>D@<@G@>AB@B?8AA>CE@D8@B=?CC>AG
@ERR127302.1707 HWI-EAS350_0441:1:1:1461:6983#0/1
CGACGCTGACACCGGAACGGCAGCAGCAGCAGGACGATTAAGACAAGGAGGATGGCTCCACAGACGCTCATG
+
GEEGEGE@GGGGGGEGGGGGBB>G3?33?8*;;79?<9@?DD8@DDEE888;-BB?.A##############
@ERR127302.1708 HWI-EAS350_0441:1:1:1461:10827#0/1
AAAGAAGGTCCTTGCAATAGACTGCCTCTGCTTGAGAACTTATGATGTAATTATTGCATGCTGCTAATATAC
+
GGGGGDDEBFGGGGGBE,DAGDDGGGEEEG<EEFDECFFEEEDE@<>ACEBEFDEEFE<EDC@E<EECCBEB
@ERR127302.1709 HWI-EAS350_0441:1:1:1461:7837#0/1
CAGCCACAGAACCACGGCACGGAAGACATGAGGCAGCATGCTCACGAGAGAGGTGAGGGTCTCCCCTCCAGG
+
HHGHHHH>DH:@.7@49;88G8>G>DDG@D>D@G@GE>@DDBDDG<A82?######################
\end{verbatim}}

\begin{frame}[fragile]{FASTQ files}

  \verb|@ERR127302.1709 HWI-EAS350\_0441:1:1:1461:7837\#0/1|
  \begin{itemize}
  \item (Anntoation), machine, flow cell, tile, coordinates, end
  \end{itemize}
  \verb|CAGCCACAGAACCACGGCACGGAAGACATGAGGCAGCATGCTCACGAGA...|
  \begin{itemize}
  \item DNA sequence, usually A, C, T, G, N (uncalled)
  \end{itemize}
  \verb|HHGHHHH>DH:@.7@49;88G8>G>DDG@D>D@G@GE>@DDBDDG<A82...|
  \begin{itemize}
  \item Quality (approximately, $-\log_{10}(p)$) encoded as ASCII characters: 
    $40$ is approximately $p=0.0001$, 30 is $p=0.001$, etc.
  \item Different encodings -- \href{http://en.wikipedia.org/wiki/FASTQ_format}{wikipedia}
  \item Higher in the alphabet is better
  \end{itemize}
\begin{knitrout}
\definecolor{shadecolor}{rgb}{0.969, 0.969, 0.969}\color{fgcolor}\begin{kframe}
\begin{verbatim}
##  !  "  #  $  %  &  '  (  )  *  +  ,  -  .  /  0  1
##  0  1  2  3  4  5  6  7  8  9 10 11 12 13 14 15 16
##  2  3  4  5  6  7  8  9  :  ;  <  =  >  ?  @  A  B
## 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33
##  C  D  E  F  G  H  I
## 34 35 36 37 38 39 40
\end{verbatim}
\end{kframe}
\end{knitrout}
\end{frame}

\begin{frame}{Quality assessment}
  Assessment, e.g., \href{http://www.bioinformatics.babraham.ac.uk/projects/fastqc/}{fastqc}
  \begin{itemize}
  \item Read length, duplication
  \item Nucleotide use: per cycle, GC content, N content, \ldots
  \item Quality: per cycle, per read
  \item Consistency across samples, without obvious treatment-specific associations
  \end{itemize}
  Remediation, e.g., \href{http://www.usadellab.org/cms/?page=trimmomatic}{trimmomatic}
  \begin{itemize}
  \item Crop e.g., leading / tailing artifacts of sequencing protocol
  \item Trim based on quality
  \end{itemize}
\end{frame}

\begin{frame}{Alignment}
  Bowtie / Tophat / Cufflinks
  \begin{itemize}
  \item \href{http://bowtie-bio.sourceforge.net/bowtie2/index.shtml}{Bowtie2} -- alignment
  \item \href{http://tophat.cbcb.umd.edu/}{Tophat} -- splice junction mapper
  \item \href{http://cufflinks.cbcb.umd.edu/}{Cufflinks} / \Biocpkg{cummeRbund} --
    isoform assembly \& quantification
  \end{itemize}
  Other aligners
  \begin{itemize}
  \item \href{http://snap.cs.berkeley.edu/}{SNAP} -- fast and accurate
  \item \href{http://subread.sourceforge.net/}{subread} / \Biocpkg{Rsubread} -- 
    memory efficient
  \item \href{http://research-pub.gene.com/gmap/}{GSNAP / GMAP} / \Biocpkg{gmapR} -- 
    flexible and high quality alignments
  \end{itemize}
\end{frame}

\begin{frame}[fragile]{BAM files}
  \begin{itemize}
  \item Visualization with, e.g., \href{http://www.broadinstitute.org/igv/}{IGV}
  \item SAM / BAM (and other) \href{https://github.com/samtools/hts-specs}{specifications}
  \end{itemize}
\begin{verbatim}
ERR127302.25553011  403 chr14  19413639  1  72M
  =       19413589        -122    
  CAAAGAATTGATTGAATTCATCAGGGCTAAAATCTCCAAAAATATACTGCGG...
  !#&&"%&$&%%&&%&"%***&'(')')")')%('#++++++*)'&%+*+*++...
  AS:i:-2 XN:i:0  XM:i:1  XO:i:0  XG:i:0  NM:i:1
  MD:Z:7C64 YT:Z:UU NH:i:3  CC:Z:=  CP:i:20145991
  HI:i:0
\end{verbatim}
\end{frame}

\begin{frame}
  \begin{tabular}{lll}
    Field & Name & Value \\\hline\noalign{\smallskip}
    1 & QNAME & Query (read) NAME \\
    2 & FLAG & Bitwise FLAG, e.g., strand of alignment \\
    3 & RNAME & Reference sequence NAME \\
    4 & POS & 1-based leftmost POSition of sequence \\
    5 & MAPQ & MAPping Quality (Phred-scaled) \\
    6 & CIGAR & Extended CIGAR string \\
    7 & MRNM & Mate Reference sequence NaMe \\
    8 & MPOS & 1-based Mate POSition \\
    9 & ISIZE & Inferred insert SIZE \\
    10 & SEQ & Query SEQuence on the reference strand \\
    11 & QUAL & Query QUALity \\
    12$+$ & OPT & OPTional fields, format TAG:VTYPE:VALUE \\\hline
  \end{tabular}
\end{frame}

\end{document}