## ----setup, echo=FALSE-------------------------------------------------------- knitr::opts_chunk$set(collapse=TRUE, comment = "#>") suppressPackageStartupMessages(library(universalmotif)) suppressPackageStartupMessages(library(Biostrings)) suppressPackageStartupMessages(library(GenomicRanges)) suppressPackageStartupMessages(library(ggbio)) data(ArabidopsisPromoters) data(ArabidopsisMotif) options(Biostrings.coloring = FALSE) ## ----------------------------------------------------------------------------- library(universalmotif) library(Biostrings) ## Create some DNA sequences for use with an external program (default ## is DNA): sequences.dna <- create_sequences(seqnum = 500, freqs = c(A=0.3, C=0.2, G=0.2, T=0.3)) ## writeXStringSet(sequences.dna, "dna.fasta") sequences.dna ## Amino acid: create_sequences(alphabet = "AA") ## Any set of characters can be used create_sequences(alphabet = paste0(letters, collapse = "")) ## ----------------------------------------------------------------------------- library(universalmotif) ## Background of DNA sequences: dna <- create_sequences() get_bkg(dna, k = 1:2) ## Background of non DNA/RNA sequences: qwerty <- create_sequences("QWERTY") get_bkg(qwerty, k = 1:2) ## ----fig.height=4.5,fig.width=4.5--------------------------------------------- library(universalmotif) ## Generate three random sets of sequences: s1 <- create_sequences(seqnum = 20, freqs = c(A = 0.3, C = 0.2, G = 0.2, T = 0.3)) s2 <- create_sequences(seqnum = 20, freqs = c(A = 0.4, C = 0.4, G = 0.1, T = 0.1)) s3 <- create_sequences(seqnum = 20, freqs = c(A = 0.2, C = 0.3, G = 0.3, T = 0.2)) ## Create a function to get properly formatted k-let counts: get_klet_matrix <- function(seqs, k, groupName) { bkg <- get_bkg(seqs, k = k, merge.res = FALSE) bkg <- bkg[, c("sequence", "klet", "count")] bkg <- reshape(bkg, idvar = "sequence", timevar = "klet", direction = "wide") suppressWarnings(as.data.frame(cbind(Group = groupName, bkg))) } ## Calculate k-let content (up to you what size k you want!): s1 <- get_klet_matrix(s1, 4, 1) s2 <- get_klet_matrix(s2, 4, 2) s3 <- get_klet_matrix(s3, 4, 3) # Combine everything into a single object: sAll <- rbind(s1, s2, s3) ## Do the PCA: sPCA <- prcomp(sAll[, -(1:2)]) ## Plot the PCA: plot(sPCA$x, col = c("red", "forestgreen", "blue")[sAll$Group], pch = 19) ## ----------------------------------------------------------------------------- library(universalmotif) library(Biostrings) data(ArabidopsisPromoters) ## Potentially starting off with some external sequences: # ArabidopsisPromoters <- readDNAStringSet("ArabidopsisPromoters.fasta") euler <- shuffle_sequences(ArabidopsisPromoters, k = 2, method = "euler") markov <- shuffle_sequences(ArabidopsisPromoters, k = 2, method = "markov") linear <- shuffle_sequences(ArabidopsisPromoters, k = 2, method = "linear") k1 <- shuffle_sequences(ArabidopsisPromoters, k = 1) ## ----------------------------------------------------------------------------- o.letter <- get_bkg(ArabidopsisPromoters, 1) e.letter <- get_bkg(euler, 1) m.letter <- get_bkg(markov, 1) l.letter <- get_bkg(linear, 1) data.frame(original=o.letter$count, euler=e.letter$count, markov=m.letter$count, linear=l.letter$count, row.names = DNA_BASES) o.counts <- get_bkg(ArabidopsisPromoters, 2) e.counts <- get_bkg(euler, 2) m.counts <- get_bkg(markov, 2) l.counts <- get_bkg(linear, 2) data.frame(original=o.counts$count, euler=e.counts$count, markov=m.counts$count, linear=l.counts$count, row.names = get_klets(DNA_BASES, 2)) ## ----------------------------------------------------------------------------- library(Biostrings) library(universalmotif) library(ggplot2) myseq <- DNAStringSet(paste0( create_sequences(seqlen = 500, freqs = c(A=0.4, T=0.4, C=0.1, G=0.1)), create_sequences(seqlen = 500) )) myseq_shuf <- shuffle_sequences(myseq) myseq_shuf_local <- shuffle_sequences(myseq, window = TRUE) myseq_bkg <- get_bkg(myseq, k = 1, window = TRUE) myseq_shuf_bkg <- get_bkg(myseq_shuf, k = 1, window = TRUE) myseq_shuf_local_bkg <- get_bkg(myseq_shuf_local, k = 1, window = TRUE) myseq_bkg$group <- "original" myseq_shuf_bkg$group <- "shuffled" myseq_shuf_local_bkg$group <- "shuffled-local" myseq_all <- suppressWarnings(as.data.frame( rbind(myseq_bkg, myseq_shuf_bkg, myseq_shuf_local_bkg) )) ggplot(myseq_all, aes(x = start, y = probability, colour = klet)) + geom_line() + theme_minimal() + scale_colour_manual(values = universalmotif:::DNA_COLOURS) + xlab(element_blank()) + facet_wrap(~group, ncol = 1) ## ----------------------------------------------------------------------------- library(universalmotif) m1 <- create_motif("TATATATATA", nsites = 50, type = "PWM", pseudocount = 1) m2 <- matrix(c(0.10,0.27,0.23,0.19,0.29,0.28,0.51,0.12,0.34,0.26, 0.36,0.29,0.51,0.38,0.23,0.16,0.17,0.21,0.23,0.36, 0.45,0.05,0.02,0.13,0.27,0.38,0.26,0.38,0.12,0.31, 0.09,0.40,0.24,0.30,0.21,0.19,0.05,0.30,0.31,0.08), byrow = TRUE, nrow = 4) m2 <- create_motif(m2, alphabet = "DNA", type = "PWM") m1["motif"] m2["motif"] ## ----------------------------------------------------------------------------- motif_pvalue(m2, pvalue = 0.001) ## ----------------------------------------------------------------------------- library(universalmotif) data(ArabidopsisMotif) data(ArabidopsisPromoters) (Example.Score <- score_match(ArabidopsisMotif, "TTCTCTTTTTTTTTT")) (Example.Pvalue <- motif_pvalue(ArabidopsisMotif, Example.Score)) (Max.Possible.Hits <- sum(width(ArabidopsisPromoters) - ncol(ArabidopsisMotif) + 1)) ## ----------------------------------------------------------------------------- (Example.bonferroni <- Example.Pvalue * Max.Possible.Hits) ## ----------------------------------------------------------------------------- (Scan.Results <- scan_sequences(ArabidopsisMotif, ArabidopsisPromoters, threshold = 0.8, threshold.type = "logodds", calc.qvals = FALSE)) ## ----------------------------------------------------------------------------- Pvalues <- Scan.Results$pvalue Pvalues.Ranks <- (rank(Pvalues) / Max.Possible.Hits) * 100 Qvalues.BH <- Pvalues / Pvalues.Ranks (Example.BH <- Qvalues.BH[Scan.Results$match == "TTCTCTTTTTTTTTT"][1]) ## ----------------------------------------------------------------------------- Scan.Results <- Scan.Results[order(Scan.Results$score, decreasing = TRUE), ] Observed.Hits <- 1:nrow(Scan.Results) Null.Hits <- Max.Possible.Hits * Scan.Results$pvalue Qvalues.fdr <- Null.Hits / Observed.Hits Qvalues.fdr <- rev(cummin(rev(Qvalues.fdr))) (Example.fdr <- Qvalues.fdr[Scan.Results$match == "TTCTCTTTTTTTTTT"][1]) ## ----------------------------------------------------------------------------- knitr::kable( data.frame( What = c("Score", "P-value", "bonferroni", "BH", "fdr"), Value = format( c(Example.Score, Example.Pvalue, Example.bonferroni, Example.BH, Example.fdr), scientific = FALSE ) ), format = "markdown", caption = "Comparing P-value correction methods" ) ## ----------------------------------------------------------------------------- library(universalmotif) library(Biostrings) data(ArabidopsisPromoters) ## A 2-letter example: motif.k2 <- create_motif("CWWWWCC", nsites = 6) sequences.k2 <- DNAStringSet(rep(c("CAAAACC", "CTTTTCC"), 3)) motif.k2 <- add_multifreq(motif.k2, sequences.k2) ## ----------------------------------------------------------------------------- scan_sequences(motif.k2, ArabidopsisPromoters, RC = TRUE, threshold = 0.9, threshold.type = "logodds") ## ----------------------------------------------------------------------------- scan_sequences(motif.k2, ArabidopsisPromoters, use.freq = 2, RC = TRUE, threshold = 0.9, threshold.type = "logodds") ## ----------------------------------------------------------------------------- motif <- create_motif("AAAAAA") ## Leave in overlapping hits: scan_sequences(motif, ArabidopsisPromoters, RC = TRUE, threshold = 0.9, threshold.type = "logodds") ## Only keep the highest scoring hit amongst overlapping hits: scan_sequences(motif, ArabidopsisPromoters, RC = TRUE, threshold = 0.9, threshold.type = "logodds", no.overlaps = TRUE) ## ----------------------------------------------------------------------------- scan_sequences(motif.k2, ArabidopsisPromoters, RC = TRUE, threshold = 0.9, threshold.type = "logodds", return.granges = TRUE) ## ----fig.height = 2.5, fig.width = 6------------------------------------------ library(universalmotif) library(GenomicRanges) library(ggbio) data(ArabidopsisPromoters) motif1 <- create_motif("AAAAAA", name = "Motif A") motif2 <- create_motif("CWWWWCC", name = "Motif B") res <- scan_sequences(c(motif1, motif2), ArabidopsisPromoters[1:10], return.granges = TRUE, calc.pvals = TRUE, no.overlaps = TRUE, threshold = 0.2, threshold.type = "logodds") ## Just plot the motif hits: autoplot(res, layout = "karyogram", aes(fill = motif, color = motif)) + theme( strip.background = element_rect(fill = NA, colour = NA), panel.background = element_rect(fill = NA, colour = NA) ) ## Plot Motif A hits by P-value: autoplot(res[res$motif.i == 1, ], layout = "karyogram", aes(fill = log10(pvalue), colour = log10(pvalue))) + scale_fill_gradient(low = "black", high = "grey75") + scale_colour_gradient(low = "black", high = "grey75") + theme( strip.background = element_rect(fill = NA, colour = NA), panel.background = element_rect(fill = NA, colour = NA) ) ## ----fig.height = 4.5, fig.width=6.5------------------------------------------ library(universalmotif) library(ggplot2) data(ArabidopsisMotif) data(ArabidopsisPromoters) res <- scan_sequences(ArabidopsisMotif, ArabidopsisPromoters, threshold = 0, threshold.type = "logodds.abs") res <- suppressWarnings(as.data.frame(res)) res$x <- mapply(function(x, y) mean(c(x, y)), res$start, res$stop) ggplot(res, aes(x, sequence, fill = score)) + scale_fill_viridis_c() + scale_x_continuous(expand = c(0, 0)) + xlim(0, 1000) + xlab(element_blank()) + ylab(element_blank()) + geom_tile(width = ncol(ArabidopsisMotif)) + theme_bw() + theme(panel.grid = element_blank(), axis.text.y = element_text(size = 6)) ## ----fig.height=5,fig.width=6.5----------------------------------------------- library(universalmotif) library(ggplot2) data(ArabidopsisMotif) data(ArabidopsisPromoters) res <- scan_sequences(ArabidopsisMotif, ArabidopsisPromoters[1:5], threshold = -Inf, threshold.type = "logodds.abs") res <- suppressWarnings(as.data.frame(res)) res$position <- mapply(function(x, y) mean(c(x, y)), res$start, res$stop) ggplot(res, aes(position, score, colour = score)) + geom_line() + geom_hline(yintercept = 0, colour = "red", alpha = 0.3) + theme_bw() + scale_colour_viridis_c() + facet_wrap(~sequence, ncol = 1) + xlab(element_blank()) + ylab(element_blank()) + theme(strip.background = element_blank()) ## ----------------------------------------------------------------------------- library(universalmotif) data(ArabidopsisMotif) data(ArabidopsisPromoters) enrich_motifs(ArabidopsisMotif, ArabidopsisPromoters, shuffle.k = 3, threshold = 0.001, RC = TRUE) ## ----------------------------------------------------------------------------- library(universalmotif) data(ArabidopsisPromoters) m1 <- create_motif("TTTATAT", name = "PartA") m2 <- create_motif("GGTTCGA", name = "PartB") ## ----------------------------------------------------------------------------- m <- cbind(m1, m2) m <- add_gap(m, gaploc = ncol(m1), mingap = 4, maxgap = 6) m ## ----------------------------------------------------------------------------- scan_sequences(m, ArabidopsisPromoters, threshold = 0.4, threshold.type = "logodds") ## ----------------------------------------------------------------------------- library(universalmotif) library(Biostrings) Ex.seq <- DNAStringSet(c( A = "GTTGAAAAAAAAAAAAAAAACAGACGT", B = "TTAGATGGCCCATAGCTTATACGGCAA", C = "AATAAAATGCTTAGGAAATCGATTGCC" )) ## ----------------------------------------------------------------------------- mask_seqs(Ex.seq, "AAAAAAAA") ## ----------------------------------------------------------------------------- (Ex.DUST <- sequence_complexity(Ex.seq, window.size = 10, method = "DUST", return.granges = TRUE)) ## ----------------------------------------------------------------------------- (Ex.DUST <- Ex.DUST[Ex.DUST$complexity >= 3]) mask_ranges(Ex.seq, Ex.DUST) ## ----eval=FALSE--------------------------------------------------------------- # library(universalmotif) # # ## 1. Once per session: via `options()` # # options(meme.bin = "/path/to/meme/bin/meme") # # run_meme(...) # # ## 2. Once per run: via `run_meme()` # # run_meme(..., bin = "/path/to/meme/bin/meme") ## ----eval=FALSE--------------------------------------------------------------- # library(universalmotif) # data(ArabidopsisPromoters) # # ## 1. Read sequences from disk (in fasta format): # # library(Biostrings) # # # The following `read*()` functions are available in Biostrings: # # DNA: readDNAStringSet # # DNA with quality scores: readQualityScaledDNAStringSet # # RNA: readRNAStringSet # # Amino acid: readAAStringSet # # Any: readBStringSet # # sequences <- readDNAStringSet("/path/to/sequences.fasta") # # run_meme(sequences, ...) # # ## 2. Extract from a `BSgenome` object: # # library(GenomicFeatures) # library(TxDb.Athaliana.BioMart.plantsmart28) # library(BSgenome.Athaliana.TAIR.TAIR9) # # # Let us retrieve the same promoter sequences from ArabidopsisPromoters: # gene.names <- names(ArabidopsisPromoters) # # # First get the transcript coordinates from the relevant `TxDb` object: # transcripts <- transcriptsBy(TxDb.Athaliana.BioMart.plantsmart28, # by = "gene")[gene.names] # # # There are multiple transcripts per gene, we only care for the first one # # in each: # # transcripts <- lapply(transcripts, function(x) x[1]) # transcripts <- unlist(GRangesList(transcripts)) # # # Then the actual sequences: # # # Unfortunately this is a case where the chromosome names do not match # # between the two databases # # seqlevels(TxDb.Athaliana.BioMart.plantsmart28) # #> [1] "1" "2" "3" "4" "5" "Mt" "Pt" # seqlevels(BSgenome.Athaliana.TAIR.TAIR9) # #> [1] "Chr1" "Chr2" "Chr3" "Chr4" "Chr5" "ChrM" "ChrC" # # # So we must first rename the chromosomes in `transcripts`: # seqlevels(transcripts) <- seqlevels(BSgenome.Athaliana.TAIR.TAIR9) # # # Finally we can extract the sequences # promoters <- getPromoterSeq(transcripts, # BSgenome.Athaliana.TAIR.TAIR9, # upstream = 1000, downstream = 0) # # run_meme(promoters, ...) ## ----eval=FALSE--------------------------------------------------------------- # run_meme(sequences, output = "/path/to/desired/output/folder") ## ----eval=FALSE--------------------------------------------------------------- # motifs <- run_meme(sequences) # motifs.k23 <- mapply(add_multifreq, motifs$motifs, motifs$sites) ## ----------------------------------------------------------------------------- library(universalmotif) string <- "DASDSDDSASDSSA" calc_complexity(string) count_klets(string, 2) shuffle_string(string, 2) ## ----------------------------------------------------------------------------- library(universalmotif) calc_windows(n = 12, window = 4, overlap = 2) get_klets(c("A", "S", "D"), 2) slide_fun("ABCDEFGH", charToRaw, raw(2), window = 2, overlap = 1) window_string("ABCDEFGH", window = 2, overlap = 1) ## ----sessionInfo, echo=FALSE-------------------------------------------------- sessionInfo()