NAME
    Geo::DNA - Encode latitude and longitude in a useful string format

SYNOPSIS
     use Geo::DNA qw( encode_geo_dna decode_geo_dna );

     my $geo = encode_geo_dna( -41.288889, 174.777222, precision => 22 );
     print "$geo\n"
     etctttagatagtgacagtcta

     my ( $lat, $lon ) = decode_geo_dna( $geo );
     print "$lat | $lon\n";
     -41.288889 | 174.777222

VERSION
        0.32

FEATURES
    * Simple API
        Generally you just convert coordinates back and forth with simple
        function calls.

    * Fast
        It's just basic space partitioning, really.

DESCRIPTION
    NEW: see an interactive demo of Geo::DNA codes at
    http://www.shoffle.com/geodna-js/docs/google-maps.html

    This is a Perl version of the Python "geoprint" system that we developed
    a few years back at Action Without Borders.

    Its purpose is to encode a latitude/longitude pair in a string format
    that can be used in text databases to locate items by proximity. For
    example, if Wellington, New Zealand has the Geo::DNA(10) value of

    etctttagat

    (which it does), then you can chop characters off the end of that to
    expand the area around Wellington. You can easily tell if items are
    close together because (for the most part) their Geo::DNA will have the
    same prefix. For example, Palmerston North, New Zealand, has a
    Geo::DNA(10) code of

    etctttaatc

    which has the same initial 7 characters.

    The original implementation of this in Python was by Michel Pelletier.

    This uses a concept that is very similar to Gustavo Niemeyer's geohash
    system ( http://geohash.org ), but encodes the latitude and longitude in
    a way that is more conducive to stem-based searching (which is probably
    the a common use of these hashing systems).

  FUNCTIONS

    `encode_geo_dna'
     my $code = encode_geo_dna( latitude, longitude, options);

    Returns a Geo::DNA code (which is a string) for latitude, longitude.
    Possible options are:

    radians => true/false
        A true value means the latitude and longitude are in radians.

    precision => Integer (defaults to 22)
        number of characters in the Geo::DNA code. Note that any more than
        22 chars and you're kinda splitting hairs.

    `decode_geo_dna'
     my ( $lat, $lon ) = decode_geo_dna( code, options )

    Returns the latitude and longitude encoded within a Geo::DNA code.

    radians => true/false
        If true, the values returned will be in radians.

    `neighbours_geo_dna'
     my $neighbours = neighbours_geo_dna( $code );

    Returns an arrayref of the 8 Geo::DNA codes representing boxes of equal
    size around the one represented by $code. This is very useful for
    proximity searching, because you can generate these Geo::DNA codes, and
    then using only textual searching (eg. a SQL "LIKE" operator), you can
    locate any items within any of those boxes.

    The precision (ie. string length) of the Geo::DNA codes will be the same
    as $code.

    `bounding_box_geo_dna'
     my ( $lats, $lons ) = Geo::DNA::bounding_box_geo_dna( $code );

    This returns an arrayref containing two arrayrefs:

     [ [ minimum latitude,  maximum latitude  ],
       [ minimum longitude, maximum longitude ],
     ]

TODO
    * Add conveniences to help you with prefix-based searching
        At present you have to understand how this geometry works fairly
        well in order to get the most out of this module.

    * Bulletproofing
        It's not particularly well-tested. And there is the boundary-problem
        in that two very close-by locations can have radically different
        Geo::DNA codes if they are on different sides of a partition. This
        is not a problem if you use the neighbouring Geo::DNA codes of your
        reference point to do proximity searching, but if you don't know how
        to do that, it will make life hard for you.

BUGS
    Please report bugs relevant to `GeoDNA' to <info[at]kyledawkins.com>.

CONTRIBUTING
    The github repository is at git://github.com/quile/geodna-perl.git.

SEE ALSO
    Some other stuff.

AUTHOR
    Kyle Dawkins, <info[at]kyledawkins.com>

COPYRIGHT AND LICENSE
    Copyright 2012 by Kyle Dawkins

    This library is free software; you can redistribute it and/or modify it
    under the same terms as Perl itself.